Kttg.org


Keyword Suggestion

Kttg no mercy
Kttg-fm
Ktt group
Kttg group



Domain Informations

Kttg.org lookup results from whois.namecheap.com server:
  • Domain created: 2002-07-06T02:58:49Z
  • Domain updated: 2025-07-04T20:32:31Z
  • Domain expires: 2026-07-06T03:04:21Z 0 Years, 155 Days left
  • Website age: 23 Years, 209 Days
  • Registrar Domain ID: REDACTED
  • Registrar Url: http://www.namecheap.com
  • Registrar WHOIS Server: whois.namecheap.com
  • Registrar Abuse Contact Email: [email protected]
  • Registrar Abuse Contact Phone: +1.9854014545
  • Name server:
    • david.ns.cloudflare.com
    • sue.ns.cloudflare.com

Network
  • inetnum : 104.16.0.0 - 104.31.255.255
  • name : CLOUDFLARENET
  • handle : NET-104-16-0-0-1
  • status : Direct Allocation
  • created : 2010-07-09
  • changed : 2024-11-25
  • desc : All Cloudflare abuse reporting can be done via https://www.cloudflare.com/abuse,Geofeed: https://api.cloudflare.com/local-ip-ranges.csv
Owner
  • organization : Cloudflare, Inc.
  • handle : CLOUD14
  • address : Array,San Francisco,CA,94107,US
Abuse
Technical support
Domain Provider Number Of Domains
godaddy.com 286730
namecheap.com 101387
networksolutions.com 69118
tucows.com 52617
publicdomainregistry.com 39120
whois.godaddy.com 32793
enomdomains.com 23825
namesilo.com 21429
domains.google.com 21384
cloudflare.com 20573
gmo.jp 18110
name.com 17601
fastdomain.com 14708
register.com 13495
net.cn 12481
ionos.com 12416
ovh.com 12416
gandi.net 12305
registrar.amazon.com 12111


Host Informations

  • IP address: 104.21.36.6
  • Location: United States
  • Latitude: 37.751
  • Longitude: -97.822
  • Timezone: America/Chicago

Check all domain's dns records


See Web Sites Hosted on 104.21.36.6

Fetching Web Sites Hosted


Site Inspections


Port Scanner (IP: 104.21.36.6)

 › Ftp: 21
 › Ssh: 22
 › Telnet: 23
 › Smtp: 25
 › Dns: 53
 › Http: 80
 › Pop3: 110
 › Portmapper, rpcbind: 111
 › Microsoft RPC services: 135
 › Netbios: 139
 › Imap: 143
 › Ldap: 389
 › Https: 443
 › SMB directly over IP: 445
 › Msa-outlook: 587
 › IIS, NFS, or listener RFS remote_file_sharing: 1025
 › Lotus notes: 1352
 › Sql server: 1433
 › Point-to-point tunnelling protocol: 1723
 › My sql: 3306
 › Remote desktop: 3389
 › Session Initiation Protocol (SIP): 5060
 › Virtual Network Computer display: 5900
 › X Window server: 6001
 › Webcache: 8080


Spam Check (IP: 104.21.36.6)

 › Dnsbl-1.uceprotect.net:
 › Dnsbl-2.uceprotect.net:
 › Dnsbl-3.uceprotect.net:
 › Dnsbl.dronebl.org:
 › Dnsbl.sorbs.net:
 › Spam.dnsbl.sorbs.net:
 › Bl.spamcop.net:
 › Recent.dnsbl.sorbs.net:
 › All.spamrats.com:
 › B.barracudacentral.org:
 › Bl.blocklist.de:
 › Bl.emailbasura.org:
 › Bl.mailspike.org:
 › Bl.spamcop.net:
 › Cblplus.anti-spam.org.cn:
 › Dnsbl.anticaptcha.net:
 › Ip.v4bl.org:
 › Fnrbl.fast.net:
 › Dnsrbl.swinog.ch:
 › Mail-abuse.blacklist.jippg.org:
 › Singlebl.spamgrouper.com:
 › Spam.abuse.ch:
 › Spamsources.fabel.dk:
 › Virbl.dnsbl.bit.nl:
 › Cbl.abuseat.org:
 › Dnsbl.justspam.org:
 › Zen.spamhaus.org:


Email address with kttg.org

Found 1 emails of this domain
1. [email protected]

Recent Searched Sites

A-comf.ru (2 seconds ago) / RU

Oneredmond.org (4 seconds ago) / US

Oouonline.com (3 seconds ago) / US

Cabletvphoneinternet.com (23 seconds ago) / US

Portal.wns.com (2 seconds ago) / IN

Standishcompliance.com (1 seconds ago) / US

504274058.zsbmspro.com (4 seconds ago) / IE

Jones-homes.co.uk (1 seconds ago) / US

Art.utah.edu (7 seconds ago) / US

Guayacansolutions.com (1 seconds ago) / CL

Prevas.dk (3 seconds ago) / SE

Prieco.net (2 seconds ago) / US

Casibomg.com (2 seconds ago) / US

Ilumac.com.br (2 seconds ago) / US

Scripties.uba.uva.nl (1 seconds ago) / NL

Bluestonerecruitment.com (5 seconds ago) / IE

Decoredeguste.com.br (1 seconds ago) / US

Revex.digital (2 seconds ago) / US

Newsfirstprime.com (1 seconds ago) / US

Kttg.org (1 seconds ago) / US

Websites Listing

We found Websites Listing below when search with kttg.org on Search Engine

Live 96.3 FM | ESPN Arkansas | KTTG | 14.9K Favorites

Web Live 96.3 FM - KTTG Ft. Smith: (14.9K Favorites) TuneIn ESPN Arkan… 14.9K Favorites Favorite Location: Ft. Smith, AR Genres: Sports Talk & News Networks: ESPN Arkansas …

Tunein.com

KTTG - Wikipedia

KTTG (96.3 FM, "ESPN Arkansas") is a radio station broadcasting a Sports radio format. Licensed to Mena, Arkansas, United States, the station serves the Hot Springs and Fort Smith. The station is currently owned by Pearson Broadcasting of Mena and features programming from ESPN Radio.

En.wikipedia.org

KTTG ESPN Sportsradio 96.3 FM | Listen Online - myTuner …

Web Listen to KTTG ESPN Sportsradio 96.3 FM live and more than 50000 online radio stations for free on mytuner-radio.com. Easy to use internet radio.

Mytuner-radio.com

CTG – Humanitarian Enablers | Committed to good

Web Specialists in staffing solutions for humanitarian & development projects in conflict-affected countries. CTG provides HR & logistic services.

Ctg.org

KTGG - Wikipedia

Web KTGG (1540 AM) is a radio station broadcasting from Okemos, Michigan, with a Christian radio format of talk and classical music.It is owned by West Central Michigan Media …

En.wikipedia.org

Tommy Craft - Market Manager - Pearson Broadcasting (KAKS

Web Market Manager at Pearson Broadcasting (KAKS-KERX-KTTG-KBCN) Co-Host of The Morning Rush Fort Smith, Arkansas, United States. 273 followers 270 connections. Join …

Linkedin.com

通視 - YouTube

Web NEWS AND STORY

Youtube.com

LIVE: ESPN Arkansas | ESPN

Web ESPN Radio Programming

Espn.com

Kawartha Trades and Technology Centre : Fleming College

Web Feb 3, 2023  · Welcome to the Kawartha Trades and Technology Centre. Many of our School of Trades and Technology programs are hosted at the Kawartha Trades and Technology …

Flemingcollege.ca

KBTG - Home - Facebook

Web KBTG, Bangkok, Thailand. 28,898 likes · 1,456 talking about this. Official KBTG (KASIKORN Business-Technology Group) Facebook Page Follow KX on...

Facebook.com

Transtubular K Gradient | QxMD

Web The transtubular potassium gradient (TTKG) is utilized to held determine whether the renal response to hyperkalemia or hypokalemia is appropriate.

Qxmd.com

KTTG 96.3 FM Radio Station - Mena, Arkansas

Web The local community served by KTTG 96.3 FM Radio Station is Mena, Arkansas. KTTG is licensed by: PEARSON BROADCASTING OF MENA, INC. PEARSON …

Phillsmith.com

QA4™ Mobile Surgery System - AneticAid

Web What is the maximum patient weight for a QA4? For a QA4 Powered Mobile Surgery System (21300), the maximum patient weight is 250kg (40 stone) in any position. For a QA4 …

Aneticaid.com

CATTG - What does CATTG stand for? The Free Dictionary

Web The MLPA oligonucleotides for the CTNS [8] (cystinosis, nephropathic) gene are as follows: exon 2, GTTTTCACACTGGGCGAAGG GAGGACT and …

Acronyms.thefreedictionary.com

Father of Madeline Kingsbury’s children says he ‘didn’t have …

Web Apr 12, 2023  · ROCHESTER, Minn. (KTTC) – The father of Madeline Kingsbury’s children released a statement Wednesday saying he did not have anything to do with her …

Kttc.com


Domains Expiration Date Updated

Site Provider Expiration Date
goruntulu-sohbet.com godaddy.com -3 Years, -22 Days
slotmachinescafe.com cosmotown.com -3 Years, -14 Days
kyloc.com register.com -3 Years, -134 Days
ruttienthetindungonline.com namecheap.com -3 Years, -280 Days
babolharam.net openprovider.com -3 Years, -55 Days
meftala.com meshdigital.com -3 Years, -310 Days
solfors.com domains.google.com -3 Years, -138 Days
parkjockey.com godaddy.com -3 Years, -13 Days
fence-shield.com domains.google.com -3 Years, -348 Days
seography.io namecheap.com -3 Years, -210 Days

    Browser All

    .com6.6M domains   

    .org1.1M domains   

    .edu63.4K domains   

    .net749.7K domains   

    .gov24.7K domains   

    .us48.5K domains   

    .ca68.2K domains   

    .de614.7K domains   

    .uk491.3K domains   

    .it57.8K domains   

    .au69.3K domains   

    .co56.7K domains   

    .biz19.4K domains   

    .info48.7K domains   

    .fr59.5K domains   

    .eu40.6K domains   

    .ru266.1K domains   

    .ph8.4K domains   

    .in85.5K domains   

    .vn25.7K domains   

    .cn85.4K domains   

    .ro28.4K domains   

    .ch23.6K domains   

    .at18.4K domains   

    Browser All